Sources

0

0xDE

6

8

80beats is DISCOVER's news aggregator, weaving together the choicest tidbits from the best articles covering the day\'s most compelling topics.

A

Helping to Personalize Medicine by Increasing Pharmacogenetics and Drug Interaction Knowledge
Biotech, Knowledge Creation
Nature Network blog posts from user 'Ian Brooks'
It is better to light a candle than to curse the darkness.
private thoughts of a physicist and chessplayer
Martin Rundkvist's blog. Archaeology, skepticism, Sweden. And books and music and stuff.
Random comments on things that interest me
Get the latest headlines from the About.com Archaeology GuideSite.
<META NAME="ROBOTS" CONTENT="NORCHIVE"> Living my life as an exclamation, not an explanation...
Cerebral Table Talk
Acronym Required observes and analyzes science and technology.
Action Potential is a blog by the editors of Nature Neuroscience – a forum for our readers, authors, and the entire neuroscience community. We’ll discuss what’s new and exciting in our journal, other journals, and neuroscience in general. We hope for spirited conversation on papers and policies. Comments will be reviewed before being published. You can be as critical or controversial as you like, but please don't get personal or discourteous, and please stay on topic. Thank you.
Discussing causes, origins, evolution, and implications of disease and other phenomena.
Anthropology, Evolution and Science
Exploring and resourcing the Ancient Near East and Egypt
Chronicling and Commenting on Human Progress
Beyond bones & stones
Ancient science and the science of ancient things
Archaeography Photoblog
Dedicated to the mathematical arts.
Issues Related to Science Teaching

B

From the Texas Hill Country: Science, Politics, Birds, and more.
Your free, fortnightly roundup of the latest psychology research from the British Psychological Society.
Consequences of Brain Science
I am an astronomer, writer, and skeptic. I likes reality the way it is, and I aims to keep it that way. My real name is Phil Plait, and I run the Bad Astronomy blog.
Ben Goldacre's Bad Science column from the Guardian and more...
Nature Network blog posts from user 'Barbara Axt'
a biophysics blog
Medical Museion @ University of Copenhagen
The global life sciences research community. A bold blog-based experiment to create the world’s largest independent life sciences community of discovery.
Advances in biological systems.
Daily tech tips, news and comment for molecular and cell biologists
Weblog of Anthony Cox
Yes, I chew on my fingers. So what ? Is that a problem to you ? Huh ? Huh ?
Topics from multidimensional biopsychosocial perspectives.
The field of neurotechnology, the focus of this blog, encompasses advances in brain science (neurons), information technology (bits) and bioengineering (genes). Up for discussion and analysis: the political, economic, ethical, and social forces that will shape the future of what will be one of the most important and fascinating stories of the coming decades.
a place where nature, photography and writing meet

C

The intersection of genetics and your health, by Matt Mealiffe, M.D.
The News Forum of the Tau Zero Foundation
A tangenital mix of blogliness, studying the effects of time, change, and chaos
Or, fun from the third floor of Wilson
Your service description
Welcome to the Chemistry World blog. If you want news, opinions and discussion about the chemical sciences, it's all here. And now you can start your own threads - just click on 'Submit a post' in the 'Pages' section below.
Climate Feedback is a blog hosted by Nature Reports: Climate Change to facilitate lively and informative discussion on the science and wider implications of global warming. The blog aims to be an informal forum for debate and commentary on climate science in our journals and others, in the news, and in the world at large.
News from the Roger Pielke Sr. Research Group
Promoting integrity in the use of climate science and related research in government
A weblog focussed mainly on the science of the past.
Physics With a Twist
Nature Network blog posts from user 'Kristin Stephan'
A new cognitive psychology article nearly every day
The Wired Science Blog
Explorations in space and science
Random samplings from a universe of ideas

D

Your Genes, Your Health, Your Choices
The intersection of genetics and your health, by Matt Mealiffe, M.D.
The intersection of genetics and your health, by Matt Mealiffe, M.D.
On the Nature of Things
This is the personal blog of Declan Butler, a senior reporter at Nature. All views expressed here are mine, and not those of Nature.
All the news on the Earth's largest environment
Walking the Web of Chemical Informatics
[ over time, across species, and cross-platform ]
My thoughts on biology, teaching, life, and exploring the living world via the digital one. Only my opinions are represented by these postings, they do not represent the viewpoints of any funding agency or Geospiza, Inc.
Jennifer Ouellette unravels our strange universe
Sex and relatonship issues that matter
Interesting and new things in mathematics for the Drexel Community.
News, events and resources from the Drexel University Libraries relating to physics.
Speculations on astronomy, astrophysics, news I find interesting, theoretical issues, science and science policy. I will digress into computational physics, science fiction and general issues and basically whatever I feel like whenever. And, of course, cats.

E

Join 12 million listeners worldwide every day for 90 seconds of science, nature and people. Hosted by Deborah Byrd and Joel Block.
Effect Measure is a forum for progressive public health discussion and argument as well as a source of public health information from around the web that interests the Editor(s)
Egyptology news from around the world.
The Life & Times of an ER Nurse
The most trafficked environmental news blog in the UK and third largest wordlwide. The main focus is on ecology and green issues.
trends, technologies and other contagions in medicine and health
Discoveries and advances in the field of epigenetics
Discoveries and advances in the field of epigenetics
remarking on the unremarkable
... not just a theory anymore.
Commentary on the Endless Dispute Between Evolution and Creationism
How will it change your life?

F

scribble, scribble, scribble. Or something.
STRATEGISTS JOURNALISTS PUBLICS
Welcome to Free Association, the Nature Genetics blog. Check here regularly for links and editorial comment on research and news in genetics, as well as reader feedback.
CATGCATGCAAAGACAACGCC
... is your freedom to understand, discuss, repair, and modify the technological devices you own.
protein science, open science and freelancing science

G

Blog and news on the benefits of genetically modified food in Africa.
rock out to the apparatus
Genetics, evolution and their various tendrils
Your genes, your life.
The future of science is here!
Carey Cuprisin a neo-agrarian doing an emergency medicine residency
Finding the fun in good math; Shredding bad math and squashing the crackpots who espouse it.
Evolution, Life Sciences, Science Education, Human Evolution, and Stuff
Science blogging the intersection between biology and technology
Ramblings of an Emergency Physician in Texas
Commentary from Dr. Stephen C. Nodvin

H

Rampaging across the world of human evolution for, oh, a good 18 months now..
The institutionalized doodles and discoveries of a dead-animal designer.
Focusing on business issues in health care. Written by David E. Williams of MedPharma Partners
IBMers and Friends on Networked, Patient-Centric Healthcare: Electronic Health Records, Health Information Exchange, Clinical Transformation, Biobanking, etc.
Spirituality in an age of scientific awareness.
Cognitive Assonance
Blood Stem Cell & Lineages
How real life impinges upon ideal science

I

Collections of notes, ideas, and thoughts of a marine community ecologist with a fondness for ascidians (that's sea squirts, to you!)
Early Christian Iconoclasm, Late Antiquity, Archaeology and more from Troels Myrup
Life, Liberty, and the Pursuit of Genetic Algorithms
Latest Infectious Disease news and articles
software development, informatics, etc.
The Integrity of Science Blog provides commentary and highlights news on attacks and misuse of science, particularly as it relates to water, climate change, and environmental security.
Nature Network blog posts from user 'Jeff Marlow'

J

This Week's Finds in Mathematical Physics

K

Second Life and Web 2.0 for Science and Technology Communication

L

Nature Network blog posts from user 'Anna Kushnir'
Latest articles on the culture of science in fiction & fact
Particle Physicist. In the wild.
Your daily dose of science scuttlebutt ...
"The universe is full of magical things, patiently waiting for our wits to grow sharper." -- Eden Phillpotts.

M

A special interest site about MALDI Mass Spectrometry Tissue Imaging and Profiling sponsored by Protein Discovery, Inc. Subscribe!
News and information for those who work in healthcare administration, including medical staff leadership, quality, accreditation, law, risk management, patient safety, and provider credentialing.
Explorations in the artistic world of macro photography.
Computer science, bioinformatics, genetics, and everything in between
A Catholic's Guide to Genetics, Genetic Engineering and Biotechnology.
Nature Network blog posts from user 'Mico Tatalovic'
A blog on microarrays and bioinformatics
The latest news about microbiology and your chance to comment
"The world moves and, deep inside, we long to move with it."
Mad rantings about politics, evolution, and microbiology
An attempt to ground and understand minds, meaning and morals within the context of a naturalistic metaphysics.
rules amended, inferences rejected
An entrée of Cognitive Science with an occasional side of whatever the hell else I want to talk about.
Conservation news and environmental science news.
Loitering With Intent
Thoughts on Science, Computing, and Life on Earth.
Here's my take on biotechnology
Dyslexia, ADHD / ADD and Autism.

N

RSS Feed for NHS Choices News pages
Nature Publishing Group's blog on web technology and science
This site is all about inviting human connection with the ecosystem, for the common good of our global community.
Feed Your Brain
An interdisciplinary forum for legal and ethical issues related to the mind and brain.
Stronger. Faster. Bloggier. Now chock full of glial goodness. **Warning** contains one giant neuro-nut.
Native plants for the southeast US, habitat restoration, and other science concerns
Nature Network blog posts from user 'Neil Neumann'
Horizontal meme transfer
Pontification without all the gritty gravitas

O

Two neuroscience bloggers team up for one chimeric blog, and world domination of course.
Two neuroscience bloggers team up for one chimeric blog, and world domination of course.
A New York Times Blog
An exploration of the serious/fun/ridiculous - past/present/future of the brain and the science that loves it.
Blogging from the trenches of medicine
Providing a communications link between zoologists and the public
synthetic procedures I tried and liked
ortholog.com: commonplacings, preponed futures, brainworthy memes, paradigm fragments, rigorously conceived musings, gists, free association on free science, stuff I have nowhere else to put. All the opinions and interpretations are my own. This site exists neither for nor despite you, but you are more than welcome to read it.
Research in the biology of aging

P

The Best of ScienceBlogs, and Beyond
Adventures, physics & random thoughts
Evolution, development, and random biological ejaculations from a godless liberal
What you want is who you can become. We are free to choose what we want, but we are not free in our wants themselves (desires and motivations), which are innate and vary across the population.
A Biotech Geek Blogger's adventures through science, technology and the web...
Nature Network blog posts from user 'Brian Clegg'
The weblog of Popular Science magazine
the life of a "non-traditional" student with a major (academic and otherwise) of undecided
The Science Policy blog. <br> Prometheus provides daily news and commentary on science policy issues.

Q

Foundations of Quantum Theory
quantised writings, science poetry, mathematical crochet and more

R

The life of Thad ...
Random variables and random ravings for all
Climate science commentary by actual climate scientists...
"A statement of fact cannot be insolent." The miscellaneous ramblings of a surgeon/scientist on medicine, quackery, science, pseudoscience, history, and pseudohistory (and anything else that interests him)
The humanitarian potential is enormous, and so is the potential for misuse...can we do this responsibly?
How new technologies are modifying our way of life
... about a little bit of forest on the edge of the Missouri Ozarks.

S

Writing about biology and other sweet things
Notes and Queries in Anthropology — A Group Blog
A science blog with Eric Berger
A blag for math, physics and the New Enlightenment
Making the world safe for scientists, one hot girl at a time
Collaborative weblog
Informed and provocative meditations on science as a creative human activity and celebration of the grandeur and mystery of the natural world.
Nature Network blog posts from user 'Massimo Pinto'
Technical Topics In Science
A constant stream of the best of ScienceBlogs
ScienceMatters@Berkeley is published online by the College of Letters and Science at the University of California, Berkeley. The mission of ScienceMatters@Berkeley is to showcase the exciting scientific research underway in the College of Letters and Science and the College of Chemistry.
Content from ScienceNewsBlog.com, which reports on cutting-edge science news, disease research, UFOs and other phenomena.
A medical student's journey inside genetics and medicine through web 2.0
Science Blog from Freelance Science Writer David Bradley
Science, science education, and other things ... with a distinctly Southern drawl
The Blog of Scott Aaronson
Blog about sleep. And sleeping good.
David Dobbs, contributor to NY Times Magazine, Scientific American, and other publications, on science, medicine, nature, and culture
Biological and medical oddities, one spore at a time.
Stem Cell Research Blog is the premier blog for news and views on Stem Cell Research and Cord Blood Banking. This blog is a labor of love from my sadness at seeing my closest of relatives suffer from diabetes and kidney diseases and my hope to see them healthy again through stem cell transplants. This blog will aim to educate people in simple words about stem cell research news and dispel myths and lies. I would consider my effort a success if it is able to help even one person. I put in lot of effort to ensure correctness and authenticity of the information presented. Corrections, if any, are always welcome. You can content me at angsuman[at]taragana[dot]net
Enders Enviromental Blog
Taking science by the throat...
News and views, Straight from the Doc
thoughts on science, history, and teaching
Random thoughts on apoptosis, bioinformatics, connections ...
Blogging a Greener World
A synthesis of ideas about open science and social technology.

T

MEDIA TO HELP YOU, HELP OTHERS "GET" SCIENCE
musings on medicines from the Earth
"It is - still - the best zoological blog out there, period"
If you have beauty questions ask the Beauty Brains! We are a group of cosmetic scientists who understand what the chemicals used in cosmetics really do, how products are tested, and what all the advertising means.
Biotech News made simple.
"Courage and cheerfulness will not only carry you over the rough places in life, but will enable you to bring comfort and help to the weak-hearted and will console you in the sad hours." -Sir William Osler
The Corpus Callosum is an occasional journal of armchair musings, by a suburban, reality-based, slightly-left-of-center guy, who reserves the right to be highly irregular at times. Topics: social commentary, neuroscience, politics, science news. Mission: to develop connections between hard science and social science, using linear thinking and intuition; and to explore the relative merits of spontaneity vs. strategy.
Daily news and views from a postdoctoral fellow in Cell Biology.
Adding DNA to the Genealogist's Toolbox
An aggregation of feeds from Highlight HEALTH, Highlight HEALTH 2.0 and the Highlight HEALTH Web Directory.
Science at home from a science geek.
Science Fact and Science Fiction
An irregular exploration of the struggle between the power of rational discourse and the scientific method on one hand, and the forces of superstition and dogma on the other.
Blog of The Lancet journal
A blog about life, past and future. Written by DISCOVER contributing editor and columnist Carl Zimmer.
In order to form a more perfect union
This blog is intended to create discussion that leads to a better understanding of diseases of human mutation.
Genomics, life science technology , computational biology , structural biology and their inter-relationships
Theoretical Musings
Science writing of any and all connotations.
Reporting from the Crossroads of Science and Politics
Science as a way of life
The Molecular Systems Biology Blog on Systems & Synthetic Biology
Live to see it.
Cluckings on life, nature and ducks
A group blog on math, physics and philosophy
a bio blog about genetics, genomics, and biotechnology
Science and life on a string - by Kasper Olsen
Slow Takes from the Canopy of the Reality-Based Community (and occasional stochastic filtering)
A Blog For All and No One
4,512 Ph. D. students died to make this blog...

U

Physics, Politics, Pop Culture

V

W

WSJ's blog on health and the business of health.
WebMD Health - Trustworthy, Credible and Timely Health Information
Notes from the life of a bioinformatics researcher

Y

@ origins genome resources .net
- dedicated to molecular gastronomy
chronicles and musings of an urban field ecologist
odysseys and flânerie on the landscape and other places
ruminations on the social and commercial potential of biotech, nanotech, infotech and computing
byline is under renovation, pardon the mess...
An American Expatriate -Upside Down Down Under
AT THE CONVERGENCE OF EVOLUTION AND GENETICS
take the next step
Just the original content. Geo-tagged for your enjoyment.
The latest science and a look at life in physics
this blog is an imported and updated version of remote central at blogspot
minor musings on the macrocosm
autistic spectrum resources and advocacy
at the intersection of neuroscience and AI.